Detail of EST/Unigene BI268167 |
Acc. | BI268167 |
Internal Acc. | NF117E02IN1F1019 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 29 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=4e-11; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=4e-11; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=6e-11; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-10; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-10; |
Length | 428 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTCACTCTCTTCTTCAATAAACCCTAATTTCCTCATTCTCTCAAAACCTTATCCATTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824514 |
Trichome-related Gene from Literature | N/A |