| Detail of EST/Unigene BI268256 |
| Acc. | BI268256 |
| Internal Acc. | NF119B01IN1F1013 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Gamma carbonic anhydrase 1, mitochondrial OS=Arabidopsis thaliana E-value=1e-33; Gamma carbonic anhydrase 3, mitochondrial OS=Arabidopsis thaliana E-value=4e-30; Gamma carbonic anhydrase 2, mitochondrial OS=Arabidopsis thaliana E-value=7e-28; Uncharacterized protein At1g47420, mitochondrial OS=Arabidopsis thaliana E-value=3e-11; |
| Length | 371 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | GCGTTACAGTGTTACCTTCTTCCACTCACCACCATTTTCCTTCTTCACATATTCCATAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |