Detail of EST/Unigene BI268256 |
Acc. | BI268256 |
Internal Acc. | NF119B01IN1F1013 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma carbonic anhydrase 1, mitochondrial OS=Arabidopsis thaliana E-value=1e-33; Gamma carbonic anhydrase 3, mitochondrial OS=Arabidopsis thaliana E-value=4e-30; Gamma carbonic anhydrase 2, mitochondrial OS=Arabidopsis thaliana E-value=7e-28; Uncharacterized protein At1g47420, mitochondrial OS=Arabidopsis thaliana E-value=3e-11; |
Length | 371 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GCGTTACAGTGTTACCTTCTTCCACTCACCACCATTTTCCTTCTTCACATATTCCATAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |