Detail of EST/Unigene BI268257 |
Acc. | BI268257 |
Internal Acc. | NF119D04IN1F1042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Furcatin hydrolase OS=Viburnum furcatum E-value=3e-15; Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=7e-15; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=2e-14; Beta-glucosidase 14 OS=Arabidopsis thaliana E-value=2e-13; Beta-glucosidase 29 OS=Oryza sativa subsp. japonica E-value=2e-13; |
Length | 607 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GTCATTTTTCTATCAACTTCCAAAGTTTTCTTAGATGGAGAAAATGGAGATTCTGTCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817104 |
Trichome-related Gene from Literature | N/A |