Detail of EST/Unigene BI268259 |
Acc. | BI268259 |
Internal Acc. | NF120B05IN1F1045 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=1e-69; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=4e-50; Carbonic anhydrase 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-49; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=5e-47; Carbonic anhydrase OS=Flaveria brownii E-value=6e-46; |
Length | 423 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GGGAAAGGGCTATGATGAAGCTATTGAAGAACTCCAAAAATTGTTGAGGGAGAAGACTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 4.2.-.- 4.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821134 |
Trichome-related Gene from Literature | N/A |