Detail of EST/Unigene BI268308 |
Acc. | BI268308 |
Internal Acc. | NF120C03IN1F1022 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=1e-31; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=2e-25; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-21; Putative lipoxygenase 5 OS=Oryza sativa subsp. japonica E-value=6e-21; Linoleate 13S-lipoxygenase 3-1, chloroplastic OS=Solanum tuberosum E-value=2e-20; |
Length | 473 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | ATAGAACAAACATCATTAAAAGTAAAAGCCATAGTAACCTGTTCAACCAACAGTTGGAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838314 |
Trichome-related Gene from Literature | N/A |