Detail of EST/Unigene BI268319 |
Acc. | BI268319 |
Internal Acc. | NF120D04IN1F1042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-70; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-69; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-67; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-67; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-67; |
Length | 552 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GTACATTTATCAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |