Detail of EST/Unigene BI268382 |
Acc. | BI268382 |
Internal Acc. | NF119F09IN1F1079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | WEB family protein At4g27595, chloroplastic OS=Arabidopsis thaliana E-value=8e-08; WEB family protein At3g02930, chloroplastic OS=Arabidopsis thaliana E-value=2e-07; WEB family protein At5g16730, chloroplastic OS=Arabidopsis thaliana E-value=1e-06; Putative WEB family protein At1g65010, chloroplastic OS=Arabidopsis thaliana E-value=1e-05; |
Length | 640 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GAGAGAGAGTGTAGCCACCTTGGAGACAGGAAAACAAACTCAATTTGTTTGGTTTTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828870 |
Trichome-related Gene from Literature | N/A |