| Detail of EST/Unigene BI270088 |
| Acc. | BI270088 |
| Internal Acc. | NF004B03FL1F1029 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic OS=Pisum sativum E-value=2e-79; Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic OS=Nicotiana tabacum E-value=7e-62; Aldolases N-methyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=4e-58; |
| Length | 569 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | AAGCAATGCAGAGTTGGCTCTGGACTACGGTTTCATTGAACCAAATGCAGATCGATATGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837964 |
| Trichome-related Gene from Literature | N/A |