| Detail of EST/Unigene BI270129 |
| Acc. | BI270129 |
| Internal Acc. | NF004G08FL1F1068 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-79; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=1e-78; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-77; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-77; RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment) OS=Secale cereale E-value=5e-74; |
| Length | 597 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | CCAAATTGAGGCTGCAGAACAAGACTATGAAAAGGAGAAGCTTGAACGAAAGGATTGCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841996 |
| Trichome-related Gene from Literature | N/A |