Detail of EST/Unigene BI270296 |
Acc. | BI270296 |
Internal Acc. | NF006D06FL1F1058 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=5e-31; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=1e-22; Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=2e-20; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=5e-18; Glucan endo-1,3-beta-glucosidase-like protein 1 OS=Arabidopsis thaliana E-value=1e-15; |
Length | 549 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | ACCATCAACTAGCCCAGTTACTCCAGCACCCATCACTTCTGCTGGATGGTGTGTTCCTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829599 |
Trichome-related Gene from Literature | N/A |