Detail of EST/Unigene BI270356 |
Acc. | BI270356 |
Internal Acc. | NF008A05FL1F1037 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative methylesterase 11, chloroplastic OS=Arabidopsis thaliana E-value=8e-86; Putative methylesterase 13, chloroplastic OS=Arabidopsis thaliana E-value=6e-73; Putative methylesterase 15, chloroplastic OS=Arabidopsis thaliana E-value=5e-69; Putative methylesterase 14, chloroplastic OS=Arabidopsis thaliana E-value=2e-55; Putative methylesterase 12, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; |
Length | 660 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GTTAAGCCTCTTACCAACTTCCTTGAAAATCTTCCTGAAGGCCAAAAGGTGATCTTGGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822677 |
Trichome-related Gene from Literature | N/A |