| Detail of EST/Unigene BI270392 |
| Acc. | BI270392 |
| Internal Acc. | NF010F02FL1F1027 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Glycine max E-value=3e-39; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Nicotiana tabacum E-value=2e-36; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Brassica napus E-value=2e-36; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Solanum lycopersicum E-value=4e-35; Glutamate-1-semialdehyde 2,1-aminomutase 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-35; |
| Length | 426 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | AATATAAAGAGAGAGAGAGAGAGATTGAGAATCTTATCTATCATTCTGAAATGGCTGCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836476 |
| Trichome-related Gene from Literature | N/A |