Detail of EST/Unigene BI270392 |
Acc. | BI270392 |
Internal Acc. | NF010F02FL1F1027 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Glycine max E-value=3e-39; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Nicotiana tabacum E-value=2e-36; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Brassica napus E-value=2e-36; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Solanum lycopersicum E-value=4e-35; Glutamate-1-semialdehyde 2,1-aminomutase 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-35; |
Length | 426 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | AATATAAAGAGAGAGAGAGAGAGATTGAGAATCTTATCTATCATTCTGAAATGGCTGCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836476 |
Trichome-related Gene from Literature | N/A |