Detail of EST/Unigene BI270574 |
Acc. | BI270574 |
Internal Acc. | NF010E06FL1F1051 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S8, chloroplastic OS=Glycine max E-value=1e-60; 30S ribosomal protein S8, chloroplastic OS=Lotus japonicus E-value=1e-59; 30S ribosomal protein S8, chloroplastic OS=Phaseolus angularis E-value=1e-58; 30S ribosomal protein S8, chloroplastic OS=Vitis vinifera E-value=7e-57; 30S ribosomal protein S8, chloroplastic OS=Phaseolus vulgaris E-value=9e-57; |
Length | 574 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | TCTATATTATAGATTTACATTATACTGATTAGACTAATTAGAATTTTCTATCTATATATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |