Detail of EST/Unigene BI270635 |
Acc. | BI270635 |
Internal Acc. | NF052A06FL1F1049 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F10 OS=Arabidopsis thaliana E-value=6e-61; Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=7e-60; Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=9e-47; Glutathione S-transferase F12 OS=Arabidopsis thaliana E-value=8e-40; Glutathione S-transferase F13 OS=Arabidopsis thaliana E-value=4e-39; |
Length | 663 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | CTCAAACTGCAGCCTTTTGGAGAGGTTCCTCTTGTTCAAGATGGTGATTATACCCTCTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817637 |
Trichome-related Gene from Literature | N/A |