Detail of EST/Unigene BI270662 |
Acc. | BI270662 |
Internal Acc. | NF052C07FL1F1054 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=0; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=0; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=0; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=3e-99; Zeaxanthin 7,8(7',8')-cleavage dioxygenase, chromoplast OS=Crocus sativus E-value=2e-32; |
Length | 657 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | TATGACAAGAGATTGGGCCATAACTTCACCGCTCATCCAAAAGTTGATCCATTTACTGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825527 |
Trichome-related Gene from Literature | N/A |