| Detail of EST/Unigene BI270674 |
| Acc. | BI270674 |
| Internal Acc. | NF056H05FL1F1048 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Tu, chloroplastic OS=Pisum sativum E-value=4e-34; Elongation factor Tu, chloroplastic OS=Arabidopsis thaliana E-value=2e-32; Elongation factor Tu, chloroplastic OS=Glycine max E-value=1e-31; Elongation factor Tu, chloroplastic OS=Glycine max E-value=1e-31; Elongation factor TuB, chloroplastic OS=Nicotiana sylvestris E-value=3e-29; |
| Length | 481 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GACATTCACCTTTCTTTGCTGGTTATAGGCCTCAGTTTTACATGAGAACTACAGATGTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.5.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827784 |
| Trichome-related Gene from Literature | N/A |