Detail of EST/Unigene BI270881 |
Acc. | BI270881 |
Internal Acc. | NF056E08FL1F1067 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-20; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=2e-20; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=2e-20; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=3e-20; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=3e-20; |
Length | 179 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | CGCAATGGTGTTAAATTCGGTGAGGCTGTATGGTTCAAGGCCGGATCCCAGATCTTTAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |