Detail of EST/Unigene BI271067 |
Acc. | BI271067 |
Internal Acc. | NF005E11FL1F1087 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L16, chloroplastic (Fragment) OS=Vigna unguiculata E-value=3e-62; 50S ribosomal protein L16, chloroplastic OS=Helianthus annuus E-value=1e-60; 50S ribosomal protein L16, chloroplastic OS=Guizotia abyssinica E-value=1e-60; 50S ribosomal protein L16, chloroplastic OS=Glycine max E-value=1e-59; 50S ribosomal protein L16, chloroplastic OS=Phaseolus angularis E-value=2e-59; |
Length | 639 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GCAAGATATACAAATTTCTAATATGTCAAAAAATCCCGCGATTGTATTCTATTTTAAATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |