Detail of EST/Unigene BI271132 |
Acc. | BI271132 |
Internal Acc. | NF005F12FL1F1103 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=4e-26; Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Cucumis sativus E-value=4e-26; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=4e-26; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-26; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=7e-26; |
Length | 275 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GTTAAGGAACTCAAGAACGGTAGATTAGCCATGTTCTCTATGTTCGGATTCTTTGTTCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |