Detail of EST/Unigene BI271153 |
Acc. | BI271153 |
Internal Acc. | NF007C05FL1F1038 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyllide a oxygenase, chloroplastic OS=Arabidopsis thaliana E-value=6e-37; Chlorophyllide a oxygenase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-33; Chlorophyllide a oxygenase, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-20; Chlorophyllide a oxygenase, chloroplastic OS=Dunaliella salina E-value=9e-19; |
Length | 542 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | AACAAGACTGCTATATAGAATGTCACTGGATTTCGCTCCCCTTCTTAAGCATATGCCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841029 |
Trichome-related Gene from Literature | N/A |