| Detail of EST/Unigene BI271153 |
| Acc. | BI271153 |
| Internal Acc. | NF007C05FL1F1038 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyllide a oxygenase, chloroplastic OS=Arabidopsis thaliana E-value=6e-37; Chlorophyllide a oxygenase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-33; Chlorophyllide a oxygenase, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-20; Chlorophyllide a oxygenase, chloroplastic OS=Dunaliella salina E-value=9e-19; |
| Length | 542 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | AACAAGACTGCTATATAGAATGTCACTGGATTTCGCTCCCCTTCTTAAGCATATGCCTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841029 |
| Trichome-related Gene from Literature | N/A |