Detail of EST/Unigene BI271178 |
Acc. | BI271178 |
Internal Acc. | NF051G08FL1F1068 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cyanogenic beta-glucosidase (Fragment) OS=Trifolium repens E-value=0; Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=7e-84; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=4e-80; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=6e-78; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=1e-77; |
Length | 662 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | ATTAAGAATGGCACCATTTAATTTCAACGTGTTTATGTTACTCTCTCTTTTATCCATTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817104 |
Trichome-related Gene from Literature | N/A |