Detail of EST/Unigene BI271255 |
Acc. | BI271255 |
Internal Acc. | NF053B08FL1F1073 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit N, chloroplastic OS=Arabidopsis thaliana E-value=2e-50; Photosystem I reaction center subunit N, chloroplastic OS=Hordeum vulgare E-value=2e-40; Photosystem I reaction center subunit N, chloroplastic (Fragment) OS=Zea mays E-value=6e-40; Photosystem I reaction center subunit N, chloroplastic OS=Volvox carteri E-value=2e-22; |
Length | 652 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | TACACATCACAGATCGATCAGCAGAACTAAACTAGCAATCCATTACACATGGCTGCAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836525 |
Trichome-related Gene from Literature | N/A |