Detail of EST/Unigene BI271357 |
Acc. | BI271357 |
Internal Acc. | NF057H12FL1F1104 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=3e-72; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=9e-69; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=1e-65; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=3e-62; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=1e-50; |
Length | 429 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GTTGCATCCTTACCGGTGTTTGGGTCATTGCACATGAGTGTGGCCACCATGCATTCAGTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820387 |
Trichome-related Gene from Literature | 820387 |