Detail of EST/Unigene BI271534 |
Acc. | BI271534 |
Internal Acc. | NF057D03FL1F1030 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=8e-62; 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=8e-62; 30S ribosomal protein S2, chloroplastic OS=Olimarabidopsis pumila E-value=2e-59; 30S ribosomal protein S2, chloroplastic OS=Nasturtium officinale E-value=2e-59; 30S ribosomal protein S2, chloroplastic OS=Lepidium virginicum E-value=2e-59; |
Length | 477 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GAAAAGAGAAGGTTCCATCGGAACAATTATTTATTGCTATTTCAGGATACCTGGTCTCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |