Detail of EST/Unigene BI271575 |
Acc. | BI271575 |
Internal Acc. | NF098F05FL1F1046 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S12, chloroplastic OS=Vitis vinifera E-value=2e-15; 30S ribosomal protein S12, chloroplastic OS=Nicotiana tabacum E-value=2e-15; 30S ribosomal protein S12, chloroplastic OS=Spinacia oleracea E-value=2e-15; 30S ribosomal protein S12, chloroplastic OS=Solanum tuberosum E-value=2e-15; 30S ribosomal protein S12, chloroplastic OS=Solanum lycopersicum E-value=2e-15; |
Length | 659 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | AATAAAGGATTACTCAAAAGTATTATCCCCATTGCATTCCAAACAAAGCATTATATTATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |