Detail of EST/Unigene BI271619 |
Acc. | BI271619 |
Internal Acc. | NF011F02FL1F1026 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L14, chloroplastic OS=Cicer arietinum E-value=2e-23; 50S ribosomal protein L14, chloroplastic OS=Glycine max E-value=5e-23; 50S ribosomal protein L14, chloroplastic OS=Draba nemorosa E-value=5e-23; 50S ribosomal protein L14, chloroplastic OS=Arabis hirsuta E-value=5e-23; 50S ribosomal protein L14, chloroplastic OS=Olimarabidopsis pumila E-value=1e-22; |
Length | 459 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GTCGTTAAACCCGGCAAAATACTTTATGAAATGGGAGGGGTCCCAGAAAATATAGCTAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |