| Detail of EST/Unigene BI271619 |
| Acc. | BI271619 |
| Internal Acc. | NF011F02FL1F1026 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L14, chloroplastic OS=Cicer arietinum E-value=2e-23; 50S ribosomal protein L14, chloroplastic OS=Glycine max E-value=5e-23; 50S ribosomal protein L14, chloroplastic OS=Draba nemorosa E-value=5e-23; 50S ribosomal protein L14, chloroplastic OS=Arabis hirsuta E-value=5e-23; 50S ribosomal protein L14, chloroplastic OS=Olimarabidopsis pumila E-value=1e-22; |
| Length | 459 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GTCGTTAAACCCGGCAAAATACTTTATGAAATGGGAGGGGTCCCAGAAAATATAGCTAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |