Detail of EST/Unigene BI271959 |
Acc. | BI271959 |
Internal Acc. | NF017B11FL1F1092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=4e-81; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=2e-79; Lichenase OS=Nicotiana plumbaginifolia E-value=3e-62; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=1e-60; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=5e-60; |
Length | 707 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | CTCAAGTTTTTATTACACTACTTTGTGCTATAGCTTTCTTTCCAAGCATGATCACAGGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |