Detail of EST/Unigene BI272069 |
Acc. | BI272069 |
Internal Acc. | NF019H08FL1F1075 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-carotene hydroxylase 2, chloroplastic (Fragment) OS=Capsicum annuum E-value=2e-70; Beta-carotene 3-hydroxylase, chloroplastic OS=Gentiana lutea E-value=5e-69; Beta-carotene hydroxylase 1, chloroplastic OS=Capsicum annuum E-value=7e-63; Beta-carotene 3-hydroxylase 1, chloroplastic OS=Arabidopsis thaliana 1 E-value=9e-63; Beta-carotene 3-hydroxylase 2, chloroplastic OS=Arabidopsis thaliana 2 E-value=2e-61; |
Length | 719 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GTAACCTTCATTCTCTTTCTCTATGGCGGCAGAACTTTACACCGCCACAACCTTAAAGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |