Detail of EST/Unigene BI272281 |
Acc. | BI272281 |
Internal Acc. | NF016E12FL1F1098 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=1e-13; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=5e-12; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=7e-12; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=1e-11; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=6e-11; |
Length | 492 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GTCAAAGAGTACCACCGGGAACACGTGGTGTGTTGCAAATCCTTATGCGGATAAAAATAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815130 |
Trichome-related Gene from Literature | N/A |