Detail of EST/Unigene BI272373 |
Acc. | BI272373 |
Internal Acc. | NF020B08FL1F1064 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-56; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=7e-56; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment) OS=Secale cereale E-value=9e-51; |
Length | 439 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | ATCAAGGCCACCCTTGCAAATGATGAAGAAAAAGTTGGAGCAGACATTGTTAAAAGAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841996 |
Trichome-related Gene from Literature | N/A |