Detail of EST/Unigene BI272416 |
Acc. | BI272416 |
Internal Acc. | NF025D02FL1F1025 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L9, chloroplastic OS=Pisum sativum E-value=1e-31; 50S ribosomal protein L9, chloroplastic OS=Arabidopsis thaliana E-value=2e-23; 50S ribosomal protein L9, chloroplastic OS=Ipomoea trifida E-value=9e-23; 50S ribosomal protein L9, chloroplastic OS=Triticum aestivum E-value=5e-19; 50S ribosomal protein L9 OS=Cyanothece sp. (strain PCC 7425 / ATCC 29141) E-value=8e-08; |
Length | 509 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | CAACAATGGCATCATCATCAACATTATCTTCACCTTCCATTGCAACATAGTTTCACCTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823623 |
Trichome-related Gene from Literature | N/A |