| Detail of EST/Unigene BI272470 |
| Acc. | BI272470 |
| Internal Acc. | NF021F04FL1F1042 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-51; Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=2e-47; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=2e-46; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=3e-45; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=6e-36; |
| Length | 474 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GAGAACAATAATATTGAGTGAGAATGGCAGCTTGTACTGTCTACTCAACACAACCTCTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840098 |
| Trichome-related Gene from Literature | N/A |