| Detail of EST/Unigene BI272484 |
| Acc. | BI272484 |
| Internal Acc. | NF026F01FL1F1014 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Betaine aldehyde dehydrogenase 2, mitochondrial OS=Arabidopsis thaliana E-value=5e-20; Betaine aldehyde dehydrogenase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-19; Betaine aldehyde dehydrogenase, chloroplastic OS=Amaranthus hypochondriacus E-value=7e-17; Betaine aldehyde dehydrogenase OS=Oryza sativa subsp. japonica E-value=3e-15; Betaine aldehyde dehydrogenase, chloroplastic OS=Beta vulgaris E-value=2e-13; |
| Length | 266 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GGAAGATGTAGACGCCGCTGTTGCCGCTGCTAAAACCGCCCTCTCCCGTAATAAAGGCGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823972 |
| Trichome-related Gene from Literature | N/A |