Detail of EST/Unigene BI272484 |
Acc. | BI272484 |
Internal Acc. | NF026F01FL1F1014 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Betaine aldehyde dehydrogenase 2, mitochondrial OS=Arabidopsis thaliana E-value=5e-20; Betaine aldehyde dehydrogenase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-19; Betaine aldehyde dehydrogenase, chloroplastic OS=Amaranthus hypochondriacus E-value=7e-17; Betaine aldehyde dehydrogenase OS=Oryza sativa subsp. japonica E-value=3e-15; Betaine aldehyde dehydrogenase, chloroplastic OS=Beta vulgaris E-value=2e-13; |
Length | 266 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GGAAGATGTAGACGCCGCTGTTGCCGCTGCTAAAACCGCCCTCTCCCGTAATAAAGGCGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823972 |
Trichome-related Gene from Literature | N/A |