Detail of EST/Unigene BI272514 |
Acc. | BI272514 |
Internal Acc. | NF022F09FL1F1078 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=6e-51; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=8e-35; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-34; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=5e-34; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; |
Length | 593 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | TAGAAGAAGAAGAAGAAGAAATAATAGTAATGGCAACCACACCTGCTTTGTATGGAACTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837639 |
Trichome-related Gene from Literature | N/A |