Detail of EST/Unigene BI272517 |
Acc. | BI272517 |
Internal Acc. | NF022H08FL1F1075 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=1e-11; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=1e-09; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-09; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=1e-09; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=4e-09; |
Length | 472 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GAGGATAAACTACAAGATGCTTTAAATTTTGCTTGTGGTGAGGGTGGTGCTGATTGCCCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815130 |
Trichome-related Gene from Literature | N/A |