| Detail of EST/Unigene BI272595 |
| Acc. | BI272595 |
| Internal Acc. | NF024F03FL1F1030 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=3e-80; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=5e-61; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=3e-59; Oxygen-evolving enhancer protein 1-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-58; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=3e-58; |
| Length | 512 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | CAGCCTCACTCCAAGCAGCTGCTACTCTCATGCAACCAACCAAGTTACGTAGCAACAGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836789 |
| Trichome-related Gene from Literature | N/A |