Detail of EST/Unigene BI272645 |
Acc. | BI272645 |
Internal Acc. | NF027A10FL1F1072 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protein LUTEIN DEFICIENT 5, chloroplastic OS=Arabidopsis thaliana E-value=0; Carotene epsilon-monooxygenase, chloroplastic OS=Arabidopsis thaliana E-value=3e-53; Cytochrome P450 97B3, chloroplastic OS=Arabidopsis thaliana E-value=6e-43; Cytochrome P450 97B2, chloroplastic OS=Glycine max E-value=1e-42; Cytochrome P450 97B1, chloroplastic OS=Pisum sativum E-value=1e-40; |
Length | 710 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | CCAGCATTGCATCTGAAGTTTGTAGCAGCTATGATCGGCCTTTTTGGACAAGCTACAGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.13.98 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840067 |
Trichome-related Gene from Literature | N/A |