Detail of EST/Unigene BI272762 |
Acc. | BI272762 |
Internal Acc. | NF025G08FL1F1067 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Tagetes erecta E-value=0; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=0; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=0; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=0; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Zea mays E-value=0; |
Length | 695 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GTCAAAGGCTACTGAGAAGAAAATTGTGGAAGCCGATGCTTATGTTGCTGCCTGTGATGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819647 |
Trichome-related Gene from Literature | N/A |