Detail of EST/Unigene BI273133 |
Acc. | BI273133 |
Internal Acc. | NF092D11FL1F1093 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=2e-58; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-42; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=2e-36; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=2e-35; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-33; |
Length | 659 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | AGACCAGGTTTCGCCAAACACGTAATAGCACCAATGCTGAAATTTCTAAGAGAAACAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824709 |
Trichome-related Gene from Literature | N/A |