| Detail of EST/Unigene BI273165 |
| Acc. | BI273165 |
| Internal Acc. | NF043G04FL1F1035 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit II, chloroplastic OS=Cucumis sativus E-value=1e-21; Photosystem I reaction center subunit II, chloroplastic OS=Solanum lycopersicum E-value=7e-21; Photosystem I reaction center subunit II, chloroplastic OS=Nicotiana sylvestris E-value=3e-20; Photosystem I reaction center subunit II, chloroplastic OS=Spinacia oleracea E-value=5e-20; |
| Length | 413 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | ATTTTTCATCATTCACTCTCACTCACACAAATAAGCATCATTCTTCTTCTTCTTCTTCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838400 |
| Trichome-related Gene from Literature | N/A |