Detail of EST/Unigene BI273165 |
Acc. | BI273165 |
Internal Acc. | NF043G04FL1F1035 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit II, chloroplastic OS=Cucumis sativus E-value=1e-21; Photosystem I reaction center subunit II, chloroplastic OS=Solanum lycopersicum E-value=7e-21; Photosystem I reaction center subunit II, chloroplastic OS=Nicotiana sylvestris E-value=3e-20; Photosystem I reaction center subunit II, chloroplastic OS=Spinacia oleracea E-value=5e-20; |
Length | 413 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | ATTTTTCATCATTCACTCTCACTCACACAAATAAGCATCATTCTTCTTCTTCTTCTTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838400 |
Trichome-related Gene from Literature | N/A |