Detail of EST/Unigene BI273168 |
Acc. | BI273168 |
Internal Acc. | NF043G06FL1F1051 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-carotene hydroxylase 2, chloroplastic (Fragment) OS=Capsicum annuum E-value=1e-24; Beta-carotene 3-hydroxylase, chloroplastic OS=Gentiana lutea E-value=5e-24; Beta-carotene hydroxylase 1, chloroplastic OS=Capsicum annuum E-value=1e-22; Beta-carotene 3-hydroxylase 1, chloroplastic OS=Arabidopsis thaliana 1 E-value=2e-21; Beta-carotene 3-hydroxylase 2, chloroplastic OS=Arabidopsis thaliana 2 E-value=9e-20; |
Length | 570 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
Sequence | GCTCACAAGGCTCTTTGGCATGCTTCCTTGTGGCACATGCATGAGTCCCATCATAGAGCA |
EST members of Unigene | BI273168 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33915.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |