| Detail of EST/Unigene BI273203 |
| Acc. | BI273203 |
| Internal Acc. | NF097G01FL1F1007 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=5e-11; Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=1e-10; Protochlorophyllide reductase C, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Protochlorophyllide reductase A, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-09; Protochlorophyllide reductase B, chloroplastic OS=Hordeum vulgare E-value=1e-08; |
| Length | 213 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GCAGAGACAGCAGCTACAGCCACTCCAGCGGTTACCAAATCTTCACCTGATGGCAAGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835507 |
| Trichome-related Gene from Literature | N/A |