Detail of EST/Unigene BI273237 |
Acc. | BI273237 |
Internal Acc. | NF098G04FL1F1035 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=4e-50; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=1e-47; Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=2e-47; Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii E-value=7e-32; Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=2e-16; |
Length | 434 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GAAGCTTTCACTGGTGTCGCATGGCAAGATGCTGGAAAGGTAGAGCTGGTGGAAGGATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818599 |
Trichome-related Gene from Literature | N/A |