Detail of EST/Unigene BI273258 |
Acc. | BI273258 |
Internal Acc. | NF097G03FL1F1023 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-methylbutanal oxime monooxygenase OS=Manihot esculenta E-value=1e-20; Cytochrome P450 71B1 OS=Thlaspi arvense E-value=2e-19; Cytochrome P450 71B12 OS=Arabidopsis thaliana E-value=1e-18; Cytochrome P450 71D10 OS=Glycine max E-value=3e-18; Cytochrome P450 71B11 OS=Arabidopsis thaliana E-value=4e-18; |
Length | 387 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | AAAAACACAAAACATCTAAGAAATCAACAACTCTTCCACCAGGTCCTAAAGGCCTTCCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07413 cytochrome P450, family 2, subfamily C |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832584 |
Trichome-related Gene from Literature | N/A |