Detail of EST/Unigene BI273315 |
Acc. | BI273315 |
Internal Acc. | NF100B11FL1F1092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Ceratophyllum demersum E-value=1e-51; 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=7e-51; 30S ribosomal protein S3, chloroplastic OS=Vitis vinifera E-value=9e-48; 30S ribosomal protein S3, chloroplastic OS=Barbarea verna E-value=2e-47; 30S ribosomal protein S3, chloroplastic OS=Olimarabidopsis pumila E-value=3e-47; |
Length | 599 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GACGAATAAAGATTAAAAAAACAATCGATCAGATTCAAGTCATAATCTATATGGTACTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |