| Detail of EST/Unigene BI273315 |
| Acc. | BI273315 |
| Internal Acc. | NF100B11FL1F1092 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Ceratophyllum demersum E-value=1e-51; 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=7e-51; 30S ribosomal protein S3, chloroplastic OS=Vitis vinifera E-value=9e-48; 30S ribosomal protein S3, chloroplastic OS=Barbarea verna E-value=2e-47; 30S ribosomal protein S3, chloroplastic OS=Olimarabidopsis pumila E-value=3e-47; |
| Length | 599 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GACGAATAAAGATTAAAAAAACAATCGATCAGATTCAAGTCATAATCTATATGGTACTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |