| Detail of EST/Unigene BI273317 |
| Acc. | BI273317 |
| Internal Acc. | NF099C02FL1F1017 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Seed linoleate 9S-lipoxygenase OS=Glycine max E-value=5e-44; Linoleate 9S-lipoxygenase 1 OS=Phaseolus vulgaris E-value=3e-41; Seed linoleate 9S-lipoxygenase-2 OS=Pisum sativum E-value=1e-39; Seed linoleate 9S-lipoxygenase-2 OS=Glycine max E-value=1e-39; Seed linoleate 13S-lipoxygenase-1 OS=Glycine max E-value=1e-37; |
| Length | 296 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | CTTGCGTTAGAAGACTACCCTTATGCCTGTTGATGGACTAAAAATATGGGATGCTATTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
| EC | 1.13.11.34 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841944 |
| Trichome-related Gene from Literature | 841944 |