Detail of EST/Unigene BI309918 |
Acc. | BI309918 |
Internal Acc. | EST5311668 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=0; Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=0; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=2e-86; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=4e-77; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=5e-65; |
Length | 815 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | TTGACAATGGTCGTATTGGTGGAAAATGAAAACCAGCACTGAGGGAGGTTACTTGAAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830336 |
Trichome-related Gene from Literature | 830336 |