Detail of EST/Unigene BI310245 |
Acc. | BI310245 |
Internal Acc. | EST5311995 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S19, chloroplastic OS=Glycine max E-value=8e-35; 30S ribosomal protein S19, chloroplastic OS=Phaseolus vulgaris E-value=8e-35; 30S ribosomal protein S19, chloroplastic OS=Phaseolus angularis E-value=8e-35; 30S ribosomal protein S19, chloroplastic OS=Pisum sativum E-value=2e-34; 30S ribosomal protein S19, chloroplastic OS=Manihot esculenta E-value=3e-34; |
Length | 780 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | GGCTTTACAAAAGAAAGAAGTGATTTACTATGACATTATATGATTTGATTTTGTTTTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |