Detail of EST/Unigene BI310456 |
Acc. | BI310456 |
Internal Acc. | EST5312206 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetate--CoA ligase ACS, chloroplastic/glyoxysomal OS=Arabidopsis thaliana E-value=0; Acetyl-coenzyme A synthetase OS=Bradyrhizobium sp. (strain ORS278) E-value=1e-95; Acetyl-coenzyme A synthetase OS=Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2) E-value=2e-95; Acetyl-coenzyme A synthetase OS=Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966) E-value=3e-95; Acetyl-coenzyme A synthetase OS=Rhodopseudomonas palustris (strain BisA53) E-value=1e-94; |
Length | 751 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | TTCTGTATGAAGGGGGCTCCCAATTATCCTGATGCTGGGCGTAGTTGGAACATTGTTGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
EC | 6.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833655 |
Trichome-related Gene from Literature | N/A |