| Detail of EST/Unigene BI310456 |
| Acc. | BI310456 |
| Internal Acc. | EST5312206 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetate--CoA ligase ACS, chloroplastic/glyoxysomal OS=Arabidopsis thaliana E-value=0; Acetyl-coenzyme A synthetase OS=Bradyrhizobium sp. (strain ORS278) E-value=1e-95; Acetyl-coenzyme A synthetase OS=Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2) E-value=2e-95; Acetyl-coenzyme A synthetase OS=Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966) E-value=3e-95; Acetyl-coenzyme A synthetase OS=Rhodopseudomonas palustris (strain BisA53) E-value=1e-94; |
| Length | 751 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD; |
| Sequence | TTCTGTATGAAGGGGGCTCCCAATTATCCTGATGCTGGGCGTAGTTGGAACATTGTTGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
| EC | 6.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 833655 |
| Trichome-related Gene from Literature | N/A |