| Detail of EST/Unigene BI310553 |
| Acc. | BI310553 |
| Internal Acc. | EST5312303 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase 2 OS=Dictyostelium discoideum E-value=8e-20; Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=8e-19; Serine hydroxymethyltransferase, cytosolic OS=Homo sapiens E-value=3e-17; Serine hydroxymethyltransferase, cytosolic OS=Pongo abelii E-value=6e-17; Serine hydroxymethyltransferase, cytosolic OS=Oryctolagus cuniculus E-value=1e-16; |
| Length | 470 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD; |
| Sequence | GGTGATAGCAGTGCCTTGGCACCTGGAGGAGTAAGGATTGGTGCCCCAGCTATGACTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827027 |
| Trichome-related Gene from Literature | N/A |